Relationship Between mtDna Mutations And Oocyte Competence

The origin and mechanism of mutant mtDNA accumulation (up to 99% in some tissues) in patients with mitochondrial diseases are still debatable. Several mutations of mitochondrial DNA occur either as sporadic large-scale rearrangements (deletions and duplications) or maternally inherited point mutations, which have been associated with defined clinical syndromes. Point mutations of mtDNA can occur in several different regions of the mitochondrial genome. Also, the severity of the clinical and biochemical phenotype correlates with the degree of mtDNA heteroplasmy in the somatic tissues. Mitochondrial mutations and rearrangements in oocytes and preimplantation embryos and resulting mito-chondrial dysfunction may have important implications for embryo development. Numerous laboratories have detected a particular mtDNA mutation called the ''common deletion,'' AmtDNA4977, in human oocytes at a frequency of 30 to 50% (Brenner et al., 1998; Barritt et al., 1999; Keefe et al., 1995). In our laboratory, this mutation was found in 30 to 50% of human oocytes. Additionally, 23 novel mtDNA rearrangements have been identified in human oocytes and embryos (Barritt et al., 1999). Using a nested PCR strategy, 51% of human oocytes and 32% of embryos exhibited mtDNA rearrangements, while multiple rearrangements were detected in 31% of oocytes and 14% of embryos. However, the important question is whether the muta-tional load actually reflects the quality of affected oocytes.

Figure 39.4 Mitochondrial hypervariable D-loop 600 bp PCR amplicon from 3 female and 1 male rhesus macaques. Samples were run on a 1.0% agarose gel at a constant voltage of 70V for 45 min. Initial primer sets have been designed, and preliminary PCR demonstrated positive amplification of a ~600 bp region of the mitochondrial D-loop of Indian origin rhesus macaques. We have now cloned and DNA sequenced the complete 1600 bp M. mulatto mitochondrial DNA, D-loop hypervariable region (see Figure 39.5). Unpublished data by Brenner et al.

Figure 39.4 Mitochondrial hypervariable D-loop 600 bp PCR amplicon from 3 female and 1 male rhesus macaques. Samples were run on a 1.0% agarose gel at a constant voltage of 70V for 45 min. Initial primer sets have been designed, and preliminary PCR demonstrated positive amplification of a ~600 bp region of the mitochondrial D-loop of Indian origin rhesus macaques. We have now cloned and DNA sequenced the complete 1600 bp M. mulatto mitochondrial DNA, D-loop hypervariable region (see Figure 39.5). Unpublished data by Brenner et al.

Hr Hlriltd mPU < OhlIß L Hrqlph

ACTCT^ACCATCCCCCATmACTACTJlTGTJUlT7CíTGCATTACT«T«CJUCA7<;TATJUTATATA GTACTJlTATATKTTUC TC7 IC ATAACACATJITTATTACATACC AACTTGACATTCCAAACJIGCATGC TT AC U^lUTiTCfltUTlCUlCCTCU£ AGTJUCACAT,UCAT«TCCeTC«ACTTAACTT(;TCCCCC CTCATSAATATVAACTAJUCCAíTCCTTWCJWTCGTCCATASTACATTAAATCCTTCATCWACATAGCA r ATATtTATTA117AATCCTteTClCCiCGGATGC CCC C CCTCAC TTAGflAJjTCCÍ TTAC TCACCATCC TC Cf^lAtTClATlTVCCXKllIMTIKTirrCTCCTCKTCCC&^CiTllCTCGT&XGGTlGCTÍT

acctsiac TcTATcccíCATctecTiTTTAccTCAiwccc ataac aatc aííatcwcí ac acíticccct

TAAATAAOACATCTCGATGGATCACGWTÍ TATCACÍC TATTAACCAGTCACGGGGAGATTTCCAT'JC ATT TCWATCTTTTATCTCTWCTflCACCCAAACCCCATTCC UAATCKTGACTÍCC ACCiCATCCCGTÍC TOA TMGCCTGTU I ItjATTCCTACTACATGCAGTTKTTCATCGCACCTJCGTTC AATiTTC TAGCTCCCGCA AACCTTT AGCA¿0»úGTjLTT7AUTC0AAA«<;AC«KC4CATC AACACTOC ATGTAfTAGCATÍAAA« GCAGCCCCAT1C lCCACCCCjlTG«GG4CAGTCJl£CATTTCCilCGGCTGCTCC AGCCAGAGATAAAAGAT Ate AAAt^At^AAATCTtCSgíCACTKTAATAOQgTCAtASAttCCTCATCCATTiAflATt; Il1 IATTT AA00MAAÍCTCT5ftKCATCTCATTCrrAT«CCCTi:A«TAAíAACCAíATíCCC0ATACA5Tr:A«T ATAfiCTACCÍCÍACiACTTITOMCCCOüAiKCAMAílACTACCACTCTTCTiCOflCATATTCXTTTCACC CAWATOCTtAtTAAÜACCCAACCAfrSMiemATAAÍCCÍCCCACCCÍCATÍTCACrfCATCCAAAÍC CtACTTTÖCtAACCCCAAAAACAAJtlQTCiTAAClTATCCIilttAtACCCTATATTTCCATTTTTAöGTCT

flCACJUCTCCAACWCCACTCCitCAATAATAAAeAmACTIi ACTAAACACCCTCTAC ACC UCCCCCA AC AAATCCTTCTCA7ACAACCC0AJUMGGCT0CCTCAC AATATAC TAOCACC TTTaTTTATGTAGCTTAA ACCCACCCAAA^AACACACTiAAAATW^TAi^TUCit^TTCCACACCCCATAAACATATAWlCTTiCTlCC TWCCTTTC TATTA5CTCTTWC AGGITTACACATCCAAACATCCTCOCTCCCCGAJIGACGCCCTACAAAT

Was this article helpful?

0 0
Blood Pressure Health

Blood Pressure Health

Your heart pumps blood throughout your body using a network of tubing called arteries and capillaries which return the blood back to your heart via your veins. Blood pressure is the force of the blood pushing against the walls of your arteries as your heart beats.Learn more...

Get My Free Ebook


Post a comment