Info

" Assembled in part from summaries presented by McCann, S. Mv (1991). Neuroregulatory peptides. In "Brain Endocrinology" (M. Motta, ed.), pp. 1-30. 2nd Ed., Raven Press, New York, with permission. (+), causes release, (-), inhibits release. h A peptide of molecular weight less than 5000. c Indirect effect through CRH. d Exerted through a primary effect on GHRH.

though these may represent the major regulators. Table 3-3 summarizes many other brain peptides that can effect the release of pituitary hormones in addition to the releasing hormones themselves. Consequently, the regulation of pituitary hormone release is potentially complicated, and until the prominent regulators are sorted out from the auxiliary or secondary agents the picture will remain complex. Nevertheless, it will suit our purposes to concentrate on the basic system summarized in Table 3-1.

D. TRH and GnRH Receptors

Of the cell membrane receptors for the releasing hormones, the TRH receptor has been cloned and its three-dimensional structure has been determined by X-ray crystallography. It and the GnRH receptor are the only receptors for the releasing hormones whose structural coordinates are registered in the data bases. Consequently, this receptor will be discussed in some detail, trusting that some of the other releasing hormone receptors may have similar characteristics.

Two TRH receptors are encoded by two DNA molecules. In one, there is a 52-basepair deletion to yield a receptor that is shorter by 25 amino acids but contains 12 new amino acid residues at the C-terminal end. This isoform occurs by alternative splicing. Both forms of the receptor are functionally similar in a test system. The second form is of interest because TRH receptors are known to couple to either phospholipase C (to produce diacylglycerol and stimulate the protein kinase C pathway) or adenylate cyclase (to produce cyclic AMP and stimulate the protein kinase A pathway). Importantly, the question remains whether there is one receptor that couples both transducers or two forms of the TRH receptor that couple to each pathway independently.

The secondary structure of TRH receptor is shown in Figure 3-11. It has seven membrane-spanning domains reminiscent of the adrenergic receptor, with three external loops and a side chain on the outside surface of the cell and four loops and an extended side chain from the region of the fourth loop on the cytoplasmic side. The region of the 52-base pair deletion is shown in the figure. The internal side chain has several phosphorylation sites, and these are identified as sites for phosphorylations by protein kinase C, protein kinase A, and casein kinase II.

The human GnRH receptor has been cloned and sequenced. It, like the TRH receptor, has a seven-membrane-spanning domain (Figure 3-12). This receptor has some similarities to the TRH receptor. The extracellular domains are qualitatively similar and the intracellular domains are too, except for the cytoplasmic tail,

TRH-R(4,2) ACTGACACGTATGTGTCAACCACAAAAGTATCATTTGATGACACCTGCTTGGCCTCCGAGAAGAATGGACCCAGTTCTTGTACATATGGATATTCTTTGACTGCCAAACAfíñAGAAAATAT TDTYVSTTKVSFDDTCL ASEKN GPSSCTYGYSLTAKQEKI~

376 387

Cure Tennis Elbow Without Surgery

Cure Tennis Elbow Without Surgery

Everything you wanted to know about. How To Cure Tennis Elbow. Are you an athlete who suffers from tennis elbow? Contrary to popular opinion, most people who suffer from tennis elbow do not even play tennis. They get this condition, which is a torn tendon in the elbow, from the strain of using the same motions with the arm, repeatedly. If you have tennis elbow, you understand how the pain can disrupt your day.

Get My Free Ebook


Post a comment