Bwb

gcaggcccagcagatacgcctgcaggccgaggccttccaggcccgcctcaagagctggttcgagcccct ggtggaagacatgcagcgccagtgggccgggctggtggagaaggtgcaggctgccgtgggcaccagcg ccgcccctgtgcccagcgacaatcactgaacgccgaagcctgcagccatgcgaccccacgccaccccgtg|

cctcctgcctccgcgcagcctgcagcgggagaccctgtccccgccccagccgtcctcctggggtggaccc tagtttaataaagattcaccaagtttcacg!

_catctgctggcctccccctgtgatttcctctaagccccagc ctcagtttctctttctgcccacatactgccacacaattctcagccccctcctctccatctgtgtctgtgtgt atctttctctctgcccitttttttttttt'agacggagtctggctctgtcacccaggctagagtgcagtggca cgatcttggctcactgcaacctctgcctcttgggttcaagcgattctgctgcctcagtagctgggattaca ggctcacaccaccacacccggctaatttttgtatttttagtagagacgagctttcaccatgttggccaggc aggtctcaaactcctgaccaagtgatccacccgccggcctcccaaagtgctgagattacaggcctgagcc acagctcactgcagcctccacctcctggactcaagtgataagtgatcctcccgcctcagcctttccagta gctgagactacaggcgcataccactaggattaatttgggggggggtggtgtgtgtggagatggggtctg gctttgttggccaggctgatgtggaattcctgggctcaagcgatactcccaccttggcctcctgagtagct cccaggctagtctcaaacccctggctcaagagatcctccgccatcggcctcccaaagtgctgggattcca ggcatgggctccgagcggcctgcccaacttaataatattgttcctagagttgcactc

Legend:

SEQUENCE: Short repeat element SEQUENCE: Alu repeat SEQUENCE: Exon, untranslated regions B SEQUENCE: Exon, coding region including signal peptide, mature peptide, stop.

Figure 4-6. Continued triplet carry their amino acid to the site, where it is concatenated to the previously joined amino acid, thus producing a polypeptide, the precursor of a functional protein. This codon-anticodon matching is how the sequence of DNA specifies, through mRNA as a temporary information carrier, the sequence of amino acids, and this is why the DNA is referred to as a modular, digital code.

Was this article helpful?

0 0

Post a comment