Taagacttcaattgggaataactgtatataaggtaaactactctgtactttaaaaaattaacatttttcttttatagggatctgaaacaacattcatgtgtgaatatgctgatgagacagcaaccattgtagaattt

ctgaacagatggattaccttttgt/aaagcatcatctcaacactgacttgataattaagtgcttcccacttaaaacatatcaggccttctatttatttaaatatttaaattttatatttattgttgaatgtatggttt

Stop codon

GCTACCTATTGTAACTATTATTCy/rAATCTTAAAACTATAAATATGGATCTTTTATGATTCTTTTTGTAAGCCCTAGGGGCTCTAAAATGGTTTCACTTATTTATCCCAAAATATTTATTATTATGTTGAATGTTAAATA

TAGTATCTATGTAGATTGGTTA//TAAAACTATTTAATAAArTTGATAAATATAAACAAGCCTGGATATTTGTTArTTTGGAAACAGCACAGAGTAAGCATTTAAATATTTCTTAGTTACTTGTGTGAACTGTAGGATG

Poly(A) consensus sequence ^3' cleavage site GTTAAAATGCTTACAAAAG//CACTCTTTCTCTGAAGAAATATGTAGAACAGAGATGTAGACTTCTCAAAAGCCCTTGCTTT 3'

You can see that non-coding introns occupy large parts of genes, even when we have left out large numbers of bases.

Exons code for less than 165 amino acids, a small protein.

I 14.20 This representation of the nucleotide sequence of the human interleukin 2 gene includes the TATA box, transcription start site, start and stop codons, introns, exons, poly(A) consensus sequence, and the 3' cleavage site.

encoded by a different gene (or, in some cases, multiple copies of a gene) in DNA.

0 0

Post a comment