Info

Chromosome—" fragments degrade

111.10 Chromosome fragments that lack a centromere are lost in mitosis.

TCACATGATGATATTTGATTTTATTATATTTTTAAAAAAAGTAAAAAATAAAAAGTAGTTTATTTTTAAAAAATAAAATTTAAAATATTTCACAAAATGATTTCCGAA AGTGTACTACTATAAACTAAAATAATATAAAAATTTTTTTCATTTTTTATTTTTCATCAAATAAAAATTTTTTATTTTAAATTTTATAAAGTGTTTTACTAAAGGCTT Region I Region II Region III

11.11 Centromeres consist of particular sequences repeated many times. This nucleotide sequence is found in the point centromere of Saccharomyces cerevisiae. It is repeated many times in the centromeric region. Each copy of the sequence has approximately 110 bp and possesses three regions. Region I (9 bp) and region III (11 bp) are located at the ends of the sequence. Region II, consisting of about 80 to 90 mostly A - T base pairs, is in the middle. No part of the centromeric sequence codes for a protein; specific centromere proteins bind to centromeric sequences and provide anchor sites for spindle fibers.

The centromeres of different organisms exhibit considerable variation in centromeric sequences. Some organisms have chromosomes with diffuse centromeres, and spindle fibers attach along the entire length of the chromosome. Most have chromosomes with localized centromeres; in these organisms, spindle fibers attach at a specific place on the chromosome. Localized centromeres appear constricted, but there also can be secondary constrictions at places that do not have centromeric functions.

Two major classes of localized centromeres are point centromeres and regional centromeres. Point centromeres are relatively small; the point centromere of budding yeast (Saccharomyces cerevisiae) encompasses 125 bp of DNA.

Regional centromeres are found on the chromosomes of fission yeast (Schizosaccharomyces pombe) and most plants and animals. In fission yeast, centromeres consist of a central core of 4000-7000 bp. This core is flanked by blocks of centromere-specific sequences that may be repeated several times. Some of these blocks have specialized functions, such as during meiosis. In Drosophila, Arabidopsis, and humans, centromeres span hundreds of thousands of base pairs. Most of the centromere is made up of short sequences of DNA that are repeated thousands of times in tandem. Within these repeats are "islands" of more complex sequence, primarily transposable element sequences. However, there do not appear to be any sequences that are unique to the centromere, which raises the question of what exactly determines where the centromere is. One possibility is that centromeres are defined not by a specific sequence but by a specific chromatin structure. In support of this idea, some nuclesomes at centromeres contain variant forms of certain histone proteins.

In addition to their roles in the attachment of the spindle fibers and the movement of chromosomes, centromeres also help control the cell cycle (see p. 000 in Chapter 2). In mitosis, the spindle fibers make contact with the kineto-chore of the centromere and orient the chromosomes on the metaphase plate. If anaphase is initiated before each chromosome is attached to the spindle fibers, chromosomes will not move toward the spindle pole and will be lost.

Research findings indicate that the commencement of anaphase is inhibited by a signal from the centromere. This inhibitory signal disappears only after the centromere of each chromosome is attached to spindle fibers from opposite poles.

Concepts 9

The centromere is a region of the chromosome to which spindle fibers attach. Centromeres display considerable variation in structure. In addition to their role in chromosome movement, centromeres also help control the cell cycle by inhibiting anaphase until chromosomes are attached to spindle fibers from both poles.

Telomere Structure

Telomeres are the natural ends of a chromosome (see p. 000 in Chapter 2). Pioneering work by Hermann Muller (on fruit flies) and Barbara McClintock (on corn) showed that chromosome breaks produce unstable ends that have a tendency to stick together and allow the chromosome to be degraded. Because attachment and degradation don't happen to the ends of a chromosome that has telomeres, each telomere must serve as a cap that stabilizes the chromosome, much like the plastic tips on the ends of a shoelace that prevent the lace from unraveling.

Telomeres also provide a means of replicating the ends of the chromosome. The enzymes that synthesize DNA are unable to replicate the last few nucleotides at the end of each newly synthesized DNA strand (discussed in Chapter 12). Consequently, a chromosome should get shorter each time its DNA is synthesized, and this progressive shortening would eventually damage genes on the chromosome. Indeed, such chromosome shortening does occur in somatic cells, which are capable of only a limited number of divisions. Germ cells and cells in single-celled organisms, however, must divide continually.

Chromosomes in these cells don't progressively shorten and self-destruct, because the cells possess an enzyme called telomerase that replicates the telomeres. The ability of telomerase to replicate a chromosome end depends on the unique molecular structure of the telomere. We will examine this mechanism of replication in Chapter 12.

Telomeres were first isolated from the protozoan Tetrahymena thermophila and were found to possess multiple copies of the sequence:

Telomeres have now been isolated from protozoans, plants, humans, and other organisms; most are similar in structure (Table 11.2). These telomeric sequences usually consist of a series of cytosine nucleotides followed by several adenine or thymine nucleotides or both, taking the form 5'-Cn(A or T)m-3', where n is 2 or greater and m is from 1 to 4. For example, the repeating unit in human telomeres is CCCTAA, which may be repeated from 250 to 1500 times. The sequence is always oriented with the string of Cs and Gs toward the end of the chromosome, as shown here:

end of 5' -CCCTAA toward

chromosome 3' -GGGATT centromere

Table 11.2 DNA sequences typically found

in telomeres of various organisms

Organism

Sequence

Tetrahymena (protozoan)

5' - CCCCAA - 3'

0 0

Post a comment