Info

Template strand

(a) Assume that this DNA molecule is from a bacterial cell. Draw in the approximate location of the promoter and terminator for this transcription unit.

(b) Assume that this DNA molecule is from a eukaryotic cell. Draw in the approximate location of an RNA polymerase II promoter.

(c) Assume that this DNA molecule is from a eukaryotic cell. Draw in the approximate location of an internal RNA polymerase III promoter.

The following DNA nucleotides are found near the end of a bacterial transcription unit. Find the terminator in this sequence.

(a) On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism?

3' - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5'

(a) Mark the point at which transcription will terminate.

(b) Is this terminator rho independent or rho dependent?

(c) Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.

*29. A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit of RNA polymerase. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see?

(a) Transcription does not take place.

(b) All RNA molecules are shorter than normal.

(c) All RNA molecules are longer than normal.

(d) Some RNA molecules are longer than normal.

(e) RNA is copied from both DNA strands.

Explain your reasoning for accepting or rejecting each of these five options.

30. Suppose that the string of As following the inverted repeat in a rho-independent terminator were deleted, but the inverted repeat were left intact. How would this deletion affect termination? What would happen when RNA polymerase reached this region?

CHALLENGE QUESTIONS]_

33. Enhancers are sequences that affect the initiation of the transcription of genes that are hundreds or thousands of nucleotides away. Enhancer-binding proteins usually interact directly with transcription factors at promoters by causing the intervening DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen, et al., 1992, Science 256:1298 -1303). Propose some additional mechanisms (other than DNA looping) by which this enhancer might affect transcription at a gene thousands of nucleotides away.

*34. The location of the TATA box in two species of yeast,

Saccharomyces pombe and S. cerevisiae, differs dramatically. The TATA box of S. pombe is about 30 nucleotides upstream of the start site, similar to the location for most other eukaryotic cells. However, the TATA box of S. cerevisiae can be as many as 120 nucleotides upstream of the start site. To understand how the TATA box functions in these two species, a series of experiments was conducted to determine which components of the transcription apparatus of these two species could be interchanged. In these experiments, different components of the transcription apparatus were switched in S. pombe and S. cerevisiae, and the effects of the switch on the level of RNA synthesis and on the start point of transcription were observed. TFIID from S. pombe could be used in S. cerevisiae cells and vice versa, without any effect on the transcription start site in either cell type. Switching TFIIB, TFIIE, or RNA polymerase did alter the level of transcription. However, the following pairs of components could be exchanged without affecting transcription: TFIIE together with TFIIH; and TFIIB together with RNA polymerase. The exchange of TFIIE - TFIIH did not alter the start point, but the exchange of TFIIB - RNA polymerase did shift it. (Y. Li, P. M. Flanagan, H. Tschochner, and R. D. Kornberg, 1994, Science 263:805-807.)

On the basis of these results, what conclusions can you draw about how the different components of the transcription apparatus interact and which components are

*31. Through genetic engineering, a geneticist mutates the gene that encodes TBP in cultured human cells. This mutation destroys the ability of TBP to bind to the TATA box. Predict the effect of this mutation on cells that possess it.

32. Elaborate repair mechanisms are associated with replication to prevent permanent mutations in DNA, yet no similar repair is associated with transcription. Can you think of a reason for these differences in replication and transcription? (Hint: Think about the relative effects of a permanent mutation in a DNA molecule compared with one in an RNA molecule.)

responsible for setting the start site? Propose a mechanism for the determination of the start site in eukaryotic RNA polymerase II promoters.

35. The relation between chromatin structure and transcription activity has been the focus of recent research. In one set of experiments, the level of in vitro transcription of a Drosophila gene by RNA polymerase II was studied with the use of DNA and various combinations of histone proteins.

First, the level of transcription was measured for naked DNA with no associated histone proteins. Then, the level of transcription was measured after nucleosome octamers (without H1) were added to the DNA. The addition of the octamers caused the level of transcription to drop by 50%. When both nucleosome octamers and H1 proteins were added to the DNA, transcription was greatly repressed, dropping to less than 1% of that obtained with naked DNA (see the table below).

GAL4-VP16 is a protein that binds to the DNA of certain eukaryotic genes. When GAL4-VP16 is added to DNA, the level of RNA polymerase II transcription is greatly elevated. Even in the presence of the H1 protein, GAL4-VP16 stimulates high levels of transcription.

Propose a mechanism for how the H1 protein represses transcription and how GAL4-VP16 overcomes this repression. Explain how your proposed mechanism would produce the results obtained in these experiments.

Relative amount of

Treatment transcription

Naked DNA 100

DNA + octamers 50

DNA + GAL4-VP16 1000

DNA + octamers + GAL4-VP16 1000

(Based on experiments reported in an article by G. E. Croston et al., 1991, Science 251:643-649.)

SUGGESTED READINGS]_

Atchinson, M. L. 1988. Enhancers: mechanisms of action and cell specificity. Annual Review of Cell Biology 4:127-154. A good review of the mechanism by which enhancers influence the transcription of distant genes. Baumann, P., S. A. Qreshi, and S. P. Jackson. 1995. Transcription: new insights from studies on archaea. Trends in Genetics 11:279-283.

A discussion of how the transcription in archaea is similar to that of eukaryotes.

Cramer, P., D. A. Bushnell, J. Fu, A. L. Gnatt, B. Maier-Davis, N. E. Thompson, R. R. Burgess, A. M. Edwards, P. R. David, and R. D. Kornberg. 2000. Architecture of RNA polymerase II and implications for the transcription mechanism. Science 288:640 - 649.

Report of the detailed structure of RNA polymerase II.

Gesteland, R. F., and J. F. Atkins. 1993. The RNA World. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Contains a number of chapters on ribozymes and their possible role in the early evolution of life. Helmann, J. D., and M. J. Chamberlin. 1988. Structure and function of bacterial sigma factors. Annual Review of Biochemistry 57:839-872.

Review of sigma factors and their role in bacterial transcription initiation.

Kim, Y., J. H. Geiger, S. Hahn, and P. B. Sigler. 1993. Crystal structure of a yeast TBP/TATA-box complex. Nature 365:512 - 527.

Report of the three-dimensional structure of the TBP protein binding to the TATA box.

Korzheva, N., A. Mustaev, M. Kozlov, A. Malhotra, V. Nikiforov, A. Goldfarb, and S. A. Darst. 2000. A structural model of transcription elongation. Science 289:619 -625. Presentation of a model of the transcription apparatus. Lee, T. I., and R. A. Young. 2000. Transcription of eukaryotic protein-encoding genes. Annual Review of Genetics 34:77-138. A good review of how eukaryotic genes are transcribed by RNA polymerase II.

Nikolov, D. B. 1992. Crystal structure of TFIID TATA-box binding protein. Nature 360:40 -45. A look at the three-dimensional structure of TFIID.

Ptashne, M., and A. Gann. 1997. Transcriptional activation by recruitment. Nature 386:569- 577.

Excellent summary of how prokaryotic and eukaryotic proteins that bind to promoters affect transcription. Rowlands, R., P. Baumann, and S. P. Jackson. 1994. The TATA-binding protein: a general transcription factor in eukaryotes and archaebacteria. Science 264:1326-1329. Report of a TATA-binding protein in archaea.

von Hippel, P. H. 1998. An integrated model of the transcription complex in elongation, termination, and editing. Science 281:660 - 665.

Review of how the transcription apparatus elongates, terminates, and edits during transcription.

Young, R. A. 1991. RNA polymerase II. Annual Review of Biochemistry 60:689 -716. A review of RNA polymerase II.

0 0

Post a comment