Concepts

Replication is extremely accurate, with less than one error per billion nucleotides. This accuracy results from the processes of nucleotide selection, proofreading, and mismatch repair.

Connecting Concepts]

The Basic Rules of Replication ira

Bacterial replication requires a number of enzymes, proteins, and DNA sequences that function together to synthesize a new DNA molecule. These components are important, but it is critical that we not become so immersed in the details of the process that we lose sight of general principles of replication.

1. Replication is always semiconservative.

2. Replication begins at sequences called origins.

3. DNA synthesis is initiated by short segments of RNA called primers.

4. The elongation of DNA strands is always in the 5' : 3' direction.

5. New DNA is synthesized from dNTPs; in the polymerization of DNA, two phosphates are cleaved from a dNTP and the resulting nucleotide is added to the 3'-OH group of the growing nucleotide strand.

Nucleotide selection

Nucleotide selection

DNA polymerase pairs nucleotides during DNA replication with a high rate of accuracy.

DNA proofreading

S^ftm^ssccaiigc

.the DNA polymerase is stalled and.

r35flATTGGGATTGG

r35flATTGGGATTGG

JS .removes the incorrect base,

. replacing it with the correct one. Replication proceeds.

JS .removes the incorrect base,

. replacing it with the correct one. Replication proceeds.

Mismatch repair ggg attcgtattaggcatagcact

0 0

Post a comment